Sub clover Marker Database

original sequence
>Tsud_sc00070.00_519173 SNP sequence
GGTGGAAGACGTGAACGAATTCAGGAAATGGTTTG[T/C]CAGACTAGGACTAAGCCTTG
ATGAAGCCTATGAAG


MarkerDB | Trifolium subterraneum