Sub clover Marker Database

original sequence
>Tsud_sc00051.00_691582 SNP sequence
CATGTTTGTAATAGTGAACTGCACAATACTGAAAT[T/C]AAATGTTTTATATACCTCAA
CAAAAATTCCAAAAT


MarkerDB | Trifolium subterraneum