Sub clover Marker Database

original sequence
>Tsud_sc00046.20_275157 SNP sequence
TTCTTATATTTATACTCATCATGATCCGCATAACC[A/G]ATGTTAGATGCATTATTCAT
AGTGTCGATATATGC


MarkerDB | Trifolium subterraneum