Sub clover Marker Database

original sequence
>Tsud_sc00039.00_1243894 SNP sequence
CAAATTTCTATCATGCATTCGATCAAATACTCGCA[C/T]GGCCAGATTAACCATACTGC
GCCGTCCATACATAT


MarkerDB | Trifolium subterraneum