Sub clover Marker Database

original sequence
>Tsud_sc00028.20_444105 SNP sequence
TATAACACATGCAATTGCTCAGCGCGCTCCATTTC[C/T]GTCATCCGAATACTGGCACA
CTGATCAGCAAAACG


MarkerDB | Trifolium subterraneum