Sub clover Marker Database

original sequence
>Tsud_sc00026.00_803587 SNP sequence
GCAATGAAAAAACCCATACAAAATTGAAAAGACTT[G/T]CTTTCTCTTCAAAGCAGAAG
TATAAATCAGTGGTC


MarkerDB | Trifolium subterraneum