Sub clover Marker Database

original sequence
>Tsud_sc00025.00_170644 SNP sequence
GGCAACCATAACTTTGTAAGAAACCTGTCCTTGTC[A/G]CAGCGCAGTAGTGAGTAGGT
GATCCAACACCAAAG


MarkerDB | Trifolium subterraneum