Sub clover Marker Database

original sequence
>Tsud_sc00025.00_1514140 SNP sequence
CATTGCTACTATTCTCTCCATCAAGTGTTACAACT[G/A]GGGTGGTGTTTTCTATTTCC
TCCATGGCTAAGATG


MarkerDB | Trifolium subterraneum