Sub clover Marker Database

original sequence
>Tsud_sc00014.00_89723 SNP sequence
TATAAAACATGGGCGAATATGGGAATTAAAAGGTC[G/A]GGAAGGCAAGTGTCAACCAC
AACTAAGTCATATCC


MarkerDB | Trifolium subterraneum