Sub clover Marker Database

original sequence
>Tsud_sc00014.00_1091781 SNP sequence
ATCATTCCAGTTGTCAGCATTGACCACCATATACA[G/T]GGAGAAAGCAGTAGGGCTGC
AGCTCAAAGACAAAG


MarkerDB | Trifolium subterraneum