Sub clover Marker Database

original sequence
>Tsud_sc00013.00_900943 SNP sequence
GGTAGGAAAGTATGTAGGGAATCTTCTATAGGTTC[T/C]AAAATTACTCAGGCAACATC
CTTTCTAACAAAGAT


MarkerDB | Trifolium subterraneum