Sub clover Marker Database

original sequence
>Tsud_sc00001.20_361693 SNP sequence
TCAAATGAGAGCCAAGTGTTGTATATGGATGCCGA[G/A]CGTCTTGAGAGTAATGTTAT
AACCGGGTTCCAACT


MarkerDB | Trifolium subterraneum