Strawberry Marker Database

original sequence
>DV438427 DV438427
ACTTTTCGAGGAGTACGAATGCGTTCTTGGGGCAAATGGGTGTCTGAAATCCGTGAGCCG
AGGAAGAAATCAAGAATTTGGTTAGGGACATATCCTACAGCTGAAATGGCTGCCCGAGCG
CACGATGTGGCTGCTCGGGCTATCAAAGGTGCTTCTGCTTATCTCAATTTCCCTGAATTG
GCTCAAACTCTTCCACAGCCGGCCTCTGCTTCTCCCAAGGACATTCAAGCTGCTGCTGCA
AAAGCTGCTTCTGCTTTGGAGGAGATGAAGAAATGTGGAGCTGAAGTGGAAGAAGAAGAA
GAGCAAGCAACACAACCCAGCAAAGATGAAGAGACAACTACTACTACTGCTAATACTAGT
ACTAGTACTAGTAACAGTACAGCTTGTTCTTCATCTTCCTCTTCAGTTGATTATGATGAC
AAATTGTTTGACCTTCCAGATCTTTTCATGGATGGCACAAATGGAAGTTATCAGTTTTGC
TTTTCTTCTTCTTCATCATCATCATGGCATCTCTGTGCAGCAGATACTGGATTCAGACTA
GAAGAGCCATTCTCGTGGGAGTATTAAATAGCAAAGTGAGTATTAAGTACTCACTGGATT
CAGTACAGTGAGTTTGTCATTGTTTTCTTCTTTTTTTATCTAAACAGAAATAATGAAGCT
TCAAAATTCAATCACATTTTGGAACAACCAGACCAGAATCATTAGCAGCTATACATTTCA
ATTGGGTTTGGTCCAGTTTGGACTTTGGACTCTATGCTGCAGAATTATGCAAAAAAAAA


MarkerDB | Fragaria x ananassa