Strawberry Marker Database

original sequence
>EX678521 EX678521
CCGCGGACATCGTCGCGTCGCAACTACCTTCTCTATGGAGCTCTCTGCTCTCTTGGCTCA
GACCTCCTTACCTCTACATCCTCATCAACTGCATCATCATCAGCATCGTCGCCTCCTCCA
AGCTCCACAGTGCTCCCAAACCCGAAGACCATCACGACTCCGAAATCATCATCCCGCCGC
CGCCGGAGATGGCCGTCGTCCCTCCGGTGAAGATCTCCGCCGCGGAAGCGAGGCCTGACT
ACGCGGCCTACAACGGCGTCGCTCTGAGCGACTACGGCTACGACTCGCATGTGTTGCCCA
AGGATTCCGATTCGTACGGCGGTGCAGTGGCGGCGGAGACCGTTGAGGTTTTGGAGCCGG
AGAATGAGATGATCAAGGTTCTGGCGGAGGTTAACGGCGGTGATAACGCCGTCACCGCCG
CATCCAGGCCTGCACGGAGTGGTCTGCAGAGGAAGGATTCCATGGAGTTTTGGTTGAATG
AGAACCAGAAACCGCCGGTTTCTTCTAGATTTGCTCACAGAAAATCCATCAGAGCTAGCC
CTGAAGGTTAGACCTTGCAAACGACTTGTCGTATTTTGTATTATTTTGAATTTTCATCGG
ATATGTGTGAAGGAACGGCCTAACCGACTGGTCGGGCTGGTCTTTCGGTGATCGGATAAA
CGTTTACCGTGAAATGTCGATATTGCCCTCATTTTTGTGAGGGGGAGCTGTGGTTTTGAA
AGACAGTGGCAAATGGTAAATTGAACGAGAATTTGT


MarkerDB | Fragaria x ananassa