| Marker name | FAES0080 | ||
|---|---|---|---|
| Marker category | FAES | ||
| Primer sequences | Fw | ACCCAGTCCACTGTGTGTG | |
| Rv | GCTGTGCTGTTTGGACTTCA | ||
| EST/Genome sequences | EF635628 | ||
| Lines | |||
| PIC | Value | ||
| Lines | 24 | ||
| Integrated Map | Locus | FAES0080 | |
| Linkage | 1A | ||
| Position | 104.4 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 214 | |
| Pattern* | AT | ||
| Repeat count | 8 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | FAES0080.jpg | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | F. x ananassa EST-SSR | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.