Soybean Marker Database

original sequence
>CA936699 CA936699
GTTGATGAGACGCAAGTTAGGACATTGGTTTATGTTGCTTTGTGGTGTGTGCAAGAGAAG
CCACGATTGAGGCCTAGCATGCCTCAAGTTGTTGATATGCTTGAAGGGCGTGTAAGGGTG
GAGATGCCACCTGATACCAGAATGGTTGTTGTTGATTTTCTATGTGTGGATGAAGAAAGT
GCAACTGATAGTAATAGCATGCCAAGGTTGGACTTTGTGTCGAATCAAAGAACACAAAGC
AATGTGGAGTCTTCTTCTACCTACTCGTTTGCTACCACCATTATGTCAGGAAGATAGAGA
TAGCAAAATTGAGTATTTGTTTCTACTAGAAATTTCATGACATTTTTTCATTACATTGTT
TTTTTTTTCTTTTCTTTATTCTCTTAATGCATTTTATTTTATATTTCTCTGTTATTGT


MarkerDB | Glycine max