Soybean Marker Database

original sequence
>AW508717 AW508717
TTCTCGTCCGTAGATTGGGAGCTAAGACCTGGTGGCATGCTTGTTCAGAAGAGACAACCC
CTTGATTCCTCTTCTAGTTCCATGATCAAAATCAAGGTCTCTCATGGTTCTTACCACCAT
GAGGTCACTGTTCCTGCACAATCCACTTTTGGGCATCTAAAAATGGTGCTTACATCCGAG
ACTGGTCTTGAGCCTAAAGAGCAAAGGTTACTATTTAGAGGGAAAGAGAGAGATGATGAT
GAATGCTTGCATATGGTGGGAGTGAAAGACATGTCTAAGGTTATATTG


MarkerDB | Glycine max