Soybean Marker Database

original sequence
>TC203450 TC203450
ACGAGGCCTCGTGCCGATTCGGCACGAGGCTCTCTTGGACTCAGTTCAGTTTCACGACCG
ATCCTACAATGGCGACAGTCACGTTTTCCTTTTCCGCTAAAACCCTAACTCTACCTTATC
ACCCCAAAACCCCAATCTCCAACTTTACCCCGGTAACGAATCTTCGCCTCCCTCCTTCTA
TCGTGACCCGAACCCGCAATTGTAACCGGATTCGGGCGGCGCTGGATGGGGATTTCTCGG
CGAAAAGGAGCAGCAGCAGCAACAACAACGACCAGAGGGAGACGATAATGTTACCTGGTT
GTGACTACAACCATTGGCTGATTGTGATGGAGTTTCCAAAGGACCCTGCACCCACCCGTG
AACAGATGATTGACACGTACCTCGACACTCTTGCCACTGTCTTGGGAAGCATGGAGGAAG
CTAAAAAGAACATGTATGCCTTTAGCACCACCACTTACACTGGATTTCAGTGCACTGTTG
ATGAAGCAACCTCCGAGAAATTCAAGGGTTTGCCTGGGGTTCTTTGGGTACTGCCAGACT
CCTATATAGATGTTAAGAACAAAGACTACGGAGGTGACAAGTACATAAATGGGGAGATTA
TTCCTTGTAAGTACCCTACCTACCAACCGAAACGTAGCGCACCAAAGAATGAGAGTAGAA
GGTATGAGAGACGGAGAGATGGCCCTCCCCCTGACCGCAGAAGGCCGAGACAAGAGGCCG
CTGCCTCGGATTCATCCTCTACATGAGCCTTGCAGGTGATTTTCAGTTTTGCTGATAGTA
ACTAATGTCAAGTGAAAGCTGCTCCTTATCACAGCTCTATCATGCTCATGGTCATTTTAA
CAAATAGAAGATTGAGCTTGTGTTGGATTCTCATCAGATGCATACAATGTTTCTTGCAAG
CTCAAACTGGTATTTTCACAATTCATCTTGAGGAATATGTGCTTTTGGACTCTGAGTATG
ACATGTGAGGCAAGTCTTAGGTTTATTTGTCTGTGTAATTTGGAGAGCTACTTATAATGC
AGCCAGTTTGTTTTCGTGATAATTTTTTTCTGCAAGTTCATGGCAGCTACAGTATTAACT
CATAAAGTGACTGATGAACTGTACAAGTTTAGATAATATGCATATATAGCCTTTTGTCAT
TATCTTAAGAAGCCAATTAATGAATCCTTAAGTTAGTCATGTTACAATAAAAAAAA


MarkerDB | Glycine max