Soybean Marker Database

original sequence
>TC225486 TC225486
ACGAGGGACGCTTTTGTTATTCTTCGTGTCTTGTTGTGTTTTTCATCTGAGATGTGTGGA
GGAGCTATCATCTCTGATTTCATTCCGGCGGCGGCGATCGCCGGGTCTCGCCGCCTGACC
GCCGATTACCTGTGGCCGGATTTGAAGAAGCGGAAGTCTGACTTGGACGTTGACTTCGAG
GCTGATTTCAGGGATTTTAAAGACGATTCTGATATCGACGACGACGACGACGATCACCAA
GTCAAGCCCTTTGCTTTCGCCGCCTCTTCTCGTCTGTCTACGGCAGCGAAATCTGTGGCA
TTCCAAGGTCGGGCTGAGATATCTGCAAATAGAAAGAGGAAGAATCAGTATAGGGGAATC
CGTCAACGCCCTTGGGGAAAATGGGCAGCTGAGATTCGGGATCCAAGAAAGGGGGTTCGT
GTCTGGCTTGGAACCTTCAACACTGCTGAAGAAGCTGCAAGAGCTTATGATGCTGAAGCA
CGGAGGATTCGTGGCAAGAAAGCCAAGGTGAATTTTCCTGAGGCACCAGGTACTTCTTCT
GTAAAACGTTCCAAGGTAAATCCACAGGAAAATCTTAAGACTGTTCAGCCCAATCTGGGT
CACAAGTTCAGTGCTGGCAACAATCACATGGATCTGGTGGAACAGAAACCCCTAGTTAGC
CAGTATGCTAACATGGCTTCCTTCCCTGGCAGTGGAAATGGGCTAAGATCCCTTCCTTCG
TCTGATGATGCAACCCTTTACTTCAGTTCAGATCAAGGGAGTAATTCATTTGATTATGCT
CCTGAGATCTCATCCATGCTTTCTGCTCCTTTGGATTGTGAATCTCATTTTGTGCAAAAT
GCCAACCAGCAGCAGCCTAACTCTCAGAATGTGGTATCTATTGAAGATGATTCTGCAAAG
ACACTCTCTGAGGAGCTTGTGGATATTGAATCTGAGTTGAAGTTCTTTCAGATGCCTTAT
CTTGAAGGGAGCTGGGGCGATACTTCATTGGAATCCTTGCTATCTGGTGACACAACTCAG
GATGGTGGAAACCTCATGAACCTTTGGTGCTTTGATGACATTCCTTCCATGGCTGGTGGA
GTTTTCTGAACCGCTTTTTCTTTGGTCTCCCTGTGTGTAAATAAAGCTACAAGTTGTTTT
TCTCTGTTTTTGATTTTTGTTGCATTTGTTGTTCTCTTGTTGGACACATCCCCCCATGTG
TCTGAAAAAAAAAATGTAATTTCCATTTTTGTTGCTTTCTGGAATGGTTGTCATCCGTGT
TGAAGATGGAGTTAAAACAATTAACTCGCTCAAGCATCTCTTGTATCTAAAGTATGGGGC
TATATAGTTATTTAGGTGTCCTTTGCCTTGTCAAAGGCCTTAGTTTTGGGGAAATCTCGA
TTGTTGTTCGAGGGTGATTATATATGATCTGTGAAACAATCTTGGCTGCTGATAATTTTT
AACTGGGTTGTTTCTCTA


MarkerDB | Glycine max