Soybean Marker Database

original sequence
>TC219822 TC219822
GGAGCCCTAAATTGAGAGTGCTACAGCTCCGACCCGGATCGAAACAAAACACCTGAACGA
CGCACACGATGTAATAGCGAAACGAAAAAACCGAGCAAGATCCAGGAACGAGGAAGCCAG
AATCGAAACCTGCATCATCATTACCATGGTGATGATGACGAGGAAGCGCCGGCGCATGAC
GGCGGTGACGGCGGCCTGCCGGAGGGTCTGATGATCGAGATCCTTGTTTGGATTAGGGTC
AGCAATCCGCTGCAATTGAGGTGCGTGTGCAAGCGGTGGAAATCCCTAGTGGTGGATCCC
CAATTCGTGAAGAAGCATTTGCACACATCGCTCTCGGACATCACGGATCTCGCGTCCAAT
GCCATGGAGGACATGAACGCGTTTCAATTGTAGCTCAATTATGCCCCTGCCTTGGCAGAA
CCAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAAATGAAGAAGAAGAAGAA
GAAGAAGAAGGAGAGGAAGAGGAAGAGGAAGAAGCGCGTTCGATGGTGAACGAGTTGGCT
CAGTTGGATAACATGTTGGTGGTGATTCGATCCCTGAAAGGAACCTTGGAAACGATTAAG
GTTGACGTTCAAGCGATCAAGGAGAGAGTGAAGTGTCTCCAGAGTTTTCTGCAGATTTAT
CTCAAGACAGCAACAGCTTCTTCCTCCTCCTCACACTCCATGTGATTGAT


MarkerDB | Glycine max