Soybean Marker Database

GMES6753 Information

Marker name GMES6753
Marker category EST-SSR
Primer sequences Fw CCCGCCAGAAAGTATACCAA
Rv AAGCTTACGGGTCAGTGCAT
EST/Genome sequences AW733556
Lines
PIC Value 0.53
Lines 24
Map1 Linkage LGI
Position 90.4
Physical Map Chromosome Gm20
Position 41725710
SNP Position
Method
SSR Fragment size 180
Pattern* AAAG
Repeat count 16
Method PCR
Detection acrylamide
Multiplex
Gel image
Enzyme
Related markers Marker name
Species Lotus japonicus
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Glycine max