Soybean Marker Database

GMES3733 Information

Marker name GMES3733
Marker category EST-SSR
Primer sequences Fw TGTCGATACAGGAAATGCCA
Rv CACAGAGTGAAGGGGGTTGT
EST/Genome sequences TC216716
Lines
PIC Value 0.08
Lines 24
Map1 Linkage LGD1b
Position 84.8
Physical Map Chromosome Gm02
Position 15142811
SNP Position
Method
SSR Fragment size 253
Pattern* GGA
Repeat count 18
Method PCR
Detection acrylamide
Multiplex
Gel image
Enzyme
Related markers Marker name CM1125.240
Species Lotus japonicus
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Glycine max