Red clover Marker Database

original sequence
>DE214080 DE214080  RCG02461
ggacagttgttgttgttgtggagagttgcctccttcatccatggattttcctctattact
cttcttccttgctcttggttcttcctcatgttgtgtcaccttcttcttcccagtattgga
cctccccatgttaaggttgaatgtggtttagagggtggaattga


MarkerDB | Trifolium pratense