Marker name | RCS6225 | ||
---|---|---|---|
Marker category | Red_clover_SSR | ||
Primer sequences | Fw | TCTTTACGTTTTCGCGGTTT | |
Rv | ATGTGTGTGGAGCAAATGGA | ||
EST/Genome sequences | BB916969 | ||
Lines | |||
PIC | Value | ||
Lines | |||
SNP | Position | ||
Method | |||
SSR | Fragment size | 90 | |
Pattern* | AAT | ||
Repeat count | 15 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.