Marker name | RCS5353 | ||
---|---|---|---|
Marker category | Red_clover_SSR | ||
Primer sequences | Fw | ACTAACCCAAACCCCAAAGG | |
Rv | CCGTTTAAGAATGGGTCGAA | ||
EST/Genome sequences | BB912799 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map (HR x R130) |
Linkage | LG4 | |
Position | 63.195 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 253 | |
Pattern* | AATT | ||
Repeat count | 24 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | RCS5353 | ||
Enzyme | |||
Related markers | Marker name | AP004963, mte1-41j24 | |
Species | Lotus japonicus, Medicago truncatula | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.