Red clover Marker Database

RCS5069 Information

Marker name RCS5069
Marker category Red_clover_SSR
Primer sequences Fw CATGTCATCTCCACCGACAC
Rv ACGGTCGATGAGTTCGTACC
EST/Genome sequences BB911389
Lines
PIC Value
Lines
Map HR x R130 Linkage LG4
Position 63.282
HR x R130 Linkage LG3
Position 74.28
SNP Position
Method
SSR Fragment size 196
Pattern* GGA
Repeat count 15
Method PCR TD
Detection 10% acrylamide
Multiplex
Gel image RCS5069
Enzyme
Related markers Marker name AP007690, mth2-12b2
Species Lotus japonicus, Medicago truncatula
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Trifolium pratense