Marker name | RCS3892 | ||
---|---|---|---|
Marker category | Red_clover_SSR | ||
Primer sequences | Fw | GGCAAAGACCAATTTTCCAA | |
Rv | GCCTATTCACCGGAATCTCA | ||
EST/Genome sequences | BB904024 | ||
Lines | |||
PIC | Value | 0.698841 | |
Lines | 48 | ||
Map | HR x R130 | Linkage | LG4 |
Position | 98.543 | ||
HR x R130 | Linkage | LG5 | |
Position | 40.89 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 131 | |
Pattern* | AGC | ||
Repeat count | 24 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | RCS3892 | ||
Enzyme | |||
Related markers | Marker name | AP010178, mth2-135i19 | |
Species | Lotus japonicus, Medicago truncatula | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.