Red clover Marker Database

RCS3554 Information

Marker name RCS3554
Marker category Red_clover_SSR
Primer sequences Fw ATAAAAGAAAACGGCGGTGA
Rv GAATCGGACCGGTCATTAAA
EST/Genome sequences DE243120
Lines
PIC Value 0.6167
Lines 48
Map HR x R130 Linkage LG3
Position 39.923
HR x R130 Linkage LG2
Position 41.949
SNP Position
Method
SSR Fragment size 222
Pattern* AT
Repeat count 32
Method PCR TD
Detection 10% acrylamide
Multiplex
Gel image RCS3554
Enzyme
Related markers Marker name
Species
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Trifolium pratense