Red clover Marker Database

RCS2467 Information

Marker name RCS2467
Marker category Red_clover_SSR
Primer sequences Fw CAAGCAGCAGAGTTTCATCA
Rv AAGGCTAGGAGTGCTGACCA
EST/Genome sequences DE227368
Lines
PIC Value
Lines
Map HR x R130 Linkage LG5
Position 30.179
HR x R130 Linkage LG2
Position 84.253
SNP Position
Method
SSR Fragment size 96
Pattern* GGA
Repeat count 14
Method PCR TD
Detection 10% acrylamide
Multiplex
Gel image RCS2467
Enzyme
Related markers Marker name
Species
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Trifolium pratense