Pepper Marker Database

CaES4527 Information

Marker name CaES4527
Marker category EST-SSR
Primer sequences Fw TTCCACTTCATTCCGTCCTC
Rv TGTCACAAACCTGGCCATAA
EST/Genome sequences GD058749
Lines
PIC Value
Lines
SNP Position
Method
SSR Fragment size 198
Pattern* AAT(mis2)
Repeat count 5
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Capsicum annuum