Peanut Marker Database

original sequence
>Ad95M22 Ad95M22
CATTTACCTCTTCTGGGGTAATGATTTGCCGCAAAACTTCCGGAAATGGGGCGGCGCCAG
CTGGGCGCGCTTCATGATTTTTCAATAACAACTCATTGTTGCGTTCAGCAACAAGAAGGC
AAGAAATTAACTCAGAATATTTTTTAAACCCTTTCTCTCGATACTGCTGCTGCAGGAGCA
CATTCGAGGCATGGAAGGTTGAGAAAGTTTTCTCCAACATATCATGATCAGTTATTTTTT
TCCCCACACAATTTCATTCGTGAGGTGATTCAAAAAATTGCAGAATTATATTCATTTATA
GATTTAAAATCTTGTAAACGCAAATGCGTCCATTCATATCGGGCCTGAGGAAGTATCACC
GTTTTCTGATAATTATACCTTTCTTCAAGGTCTTTCCAAAGATCTGCAGGATCTTTTAAT
GTAAGATATTCATTTTTCAATCCTTCGTCAAGATGACGACGGAGAAAAATCATGGCTTTG
GCTTTATCCTTCTGGGATGCATTATTTTCAGCCTTAATGGTATCTCCAAGATCCATTGAA
TTAAGATGGATTTCAGCATCTAATATCCATGATAAATAATTGTTTCCAGATATATCAAGA
GCATTGAATTCAAGATGAGAGAGTTTCGACATAATGAAAATTTGTTACCTGAGTCTTCCT
AAAAATTTGATCAGAGTCTCGTGCTGATAACGTGTTGTAAAAAATATATAAAATAAATAT
GTATAAATAGAAGACTCTATTATTAATATAATTAGCTCAATAATATTTATATATATATAT
AATAATATTATATGTTGTATTGTGTATATATATACAAAGATAGAAAGAAGTATTAAAAAT
AAAGAGAGAGAATTGCATTTGTTTATTGTTACTATCTCAATATAATAAAGATGATTAATA
TTGCTATTAATATTATATGTAAAGAGTAATAGAAAATAGAATTTAAAATACTTATAAAAT
AAAAGAAGAGAAAGAATTGTAGTAGAAA


MarkerDB | Arachis hypogaea