Peanut Marker Database

TC9F10 Information

Marker name TC9F10
Marker category Publicly available markers
Primer sequences Fw ATCACAATCACAGCTCCAACAA
Rv GGCAAGTCTAATCTCCTTTCCA
EST/Genome sequences DQ099152
Lines
PIC Value
Lines
Map SKF2 Linkage LG08.2
Position 53.322
SKF2 Linkage LG08.1
Position 133.07
NYF2 Linkage LG08.1
Position 31.688
AF5 Linkage AA08
Position 64.468
TF6 Linkage TA08
Position 59.169
Integrated consensus map Linkage A08
Position 73.938
Integrated consensus map Linkage B08
Position 53.426
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0361

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea