Peanut Marker Database

TC7H02 Information

Marker name TC7H02
Marker category Publicly available markers
Primer sequences Fw TCAGGATAATGACAGAGTGAGT
Rv GGAAGAAGACCTTTGATGAG
EST/Genome sequences DQ099232
Lines
PIC Value
Lines
Map TF6 Linkage TA09
Position 30.303
TF6 Linkage TA09
Position 33.611
Integrated consensus map Linkage A09
Position 78.315
Integrated consensus map Linkage B01
Position 40.567
Integrated consensus map Linkage A09
Position 76.111
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0350

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea