Peanut Marker Database

TC6H03 Information

Marker name TC6H03
Marker category Publicly available markers
Primer sequences Fw TCACAATCAGAGCTCCAACAA
Rv CAGGTTCACCAGGAACGAGT
EST/Genome sequences DQ099227
Lines
PIC Value
Lines
Map SKF2 Linkage LG08.2
Position 52.391
SKF2 Linkage LG08.1
Position 132.253
AF5 Linkage AA08
Position 64.468
BF6 Linkage BB08
Position 17.862
TF6 Linkage TA08
Position 61.128
TF6 Linkage TB08
Position 17.22
Integrated consensus map Linkage B08
Position 54.56
Integrated consensus map Linkage A08
Position 76.338
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0343

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea