Peanut Marker Database

TC6E01 Information

Marker name TC6E01
Marker category Publicly available markers
Primer sequences Fw CTCCCTCGCTTCCTCTTTCT
Rv ACGCATTAACCACACACCAA
EST/Genome sequences DQ099175
Lines
PIC Value
Lines
Map SKF2 Linkage LG05.2
Position 45.514
SKF2 Linkage LG05.1
Position 83.607
AF5 Linkage AA05
Position 53.65
BF6 Linkage BB05
Position 11.878
TF6 Linkage TA05
Position 24.142
Integrated consensus map Linkage A05
Position 49.138
Integrated consensus map Linkage B05
Position 53.545
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0341

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea