Peanut Marker Database

TC5C05 Information

Marker name TC5C05
Marker category Publicly available markers
Primer sequences Fw TCATCTTCACTTCCCCTTTCA
Rv CCCAACCAAATCCAACACTT
EST/Genome sequences DQ099197
Lines
PIC Value
Lines
Map BF6 Linkage BB04
Position 50.059
Integrated consensus map Linkage B04
Position 94.638
Integrated consensus map Linkage A05
Position 120.088
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0337

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea