Peanut Marker Database

TC4G02 Information

Marker name TC4G02
Marker category Publicly available markers
Primer sequences Fw GATCCAACTGTGAATTGGGC
Rv CACACCAGCAACAAGGAATC
EST/Genome sequences DQ099173
Lines
PIC Value
Lines
Map NYF2 Linkage LG03.1
Position 78.248
TF6 Linkage TB03
Position 89.957
Integrated consensus map Linkage A03
Position 135.978
Integrated consensus map Linkage B03
Position 88.705
Integrated consensus map Linkage A03
Position 121.998
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0329

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea