Peanut Marker Database

TC3G01 Information

Marker name TC3G01
Marker category Publicly available markers
Primer sequences Fw GACGGTAATCGTGCCCTAAA
Rv TGCAGTAGTGGCAGCAGAAC
EST/Genome sequences DQ099192
Lines
PIC Value
Lines
Map Integrated consensus map Linkage B08
Position 87.658
Integrated consensus map Linkage B01
Position 4.55
Integrated consensus map Linkage B01
Position 6.242
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0307

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea