Peanut Marker Database

TC3E02 Information

Marker name TC3E02
Marker category Publicly available markers
Primer sequences Fw TGAAAGATAGGTTTCGGTGGA
Rv CAAACCGAAGGAGGAACTTG
EST/Genome sequences DQ099210
Lines
PIC Value
Lines
Map BF6 Linkage BB03
Position 30.083
Integrated consensus map Linkage A09
Position 17.633
Integrated consensus map Linkage B03
Position 6.947
Integrated consensus map Linkage A03
Position 18.488
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea