Peanut Marker Database

TC3A10 Information

Marker name TC3A10
Marker category Publicly available markers
Primer sequences Fw GCATGGGGTAAATCTTCCAA
Rv ATGTGCCTATCAGGGGTTTG
EST/Genome sequences DQ099209
Lines
PIC Value
Lines
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0302

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea