Peanut Marker Database

TC39C01 Information

Marker name TC39C01
Marker category Publicly available markers
Primer sequences Fw AGGCGCGGTGATAGAAAAC
Rv GTTTTGCTGTTCGTCCCTAAAC
EST/Genome sequences JN887612
Lines
PIC Value
Lines
Map TF6 Linkage TA03
Position 26.025
Integrated consensus map Linkage A03
Position 66.24
Integrated consensus map Linkage A03
Position 66.536
Integrated consensus map Linkage A03
Position 66.209
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Macedo et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea