Peanut Marker Database

TC39B04 Information

Marker name TC39B04
Marker category Publicly available markers
Primer sequences Fw ATCTCGTTCATGCACACGTTAG
Rv ACAGTACTTGGCGTTAAGAGGG
EST/Genome sequences JN887611
Lines
PIC Value
Lines
Map TF6 Linkage TB04
Position 0.0
Integrated consensus map Linkage B04
Position 53.51
Integrated consensus map Linkage A04
Position 44.147
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Macedo et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea