| Marker name | TC27H12 | ||
|---|---|---|---|
| Marker category | Publicly available markers | ||
| Primer sequences | Fw | TAACGAATGACATCAATCCCTG | |
| Rv | TCTCACTTTGCACTCTCCTCAA | ||
| EST/Genome sequences | JN887570 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | AF5 | Linkage | AA01 |
| Position | 47.333 | ||
| TF6 | Linkage | TB01 | |
| Position | 38.665 | ||
| Integrated consensus map | Linkage | A01 | |
| Position | 96.514 | ||
| Integrated consensus map | Linkage | B01 | |
| Position | 41.687 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Macedo et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.