Peanut Marker Database

TC27H12 Information

Marker name TC27H12
Marker category Publicly available markers
Primer sequences Fw TAACGAATGACATCAATCCCTG
Rv TCTCACTTTGCACTCTCCTCAA
EST/Genome sequences JN887570
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 47.333
TF6 Linkage TB01
Position 38.665
Integrated consensus map Linkage B01
Position 41.687
Integrated consensus map Linkage A01
Position 96.514
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Macedo et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea