Peanut Marker Database

TC23E04 Information

Marker name TC23E04
Marker category Publicly available markers
Primer sequences Fw GAGAGAAAAGAGGGTAGCTTTGC
Rv TCAAAGACAAACACCAAAACCTT
EST/Genome sequences JN887545
Lines
PIC Value
Lines
Map TF6 Linkage TB03
Position 17.815
TF6 Linkage TA07
Position 19.478
Integrated consensus map Linkage A07
Position 52.341
Integrated consensus map Linkage B03
Position 17.0
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Macedo et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea