Peanut Marker Database

TC23C08 Information

Marker name TC23C08
Marker category Publicly available markers
Primer sequences Fw AGCAGAGTGGAAAACGAAGAAG
Rv GTCAGTTTGTGAATCGGGTTTT
EST/Genome sequences
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 66.994
BF6 Linkage BB06
Position 18.813
Integrated consensus map Linkage B06
Position 87.907
Integrated consensus map Linkage A01
Position 119.999
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Macedo et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea