Peanut Marker Database

TC22D09 Information

Marker name TC22D09
Marker category Publicly available markers
Primer sequences Fw CCCATGAAACAGAACAAGACAA
Rv GTCACCTGCAACCAGAACAAC
EST/Genome sequences JN887530
Lines
PIC Value
Lines
Map TF6 Linkage TB01
Position 34.92
Integrated consensus map Linkage B01
Position 39.001
Integrated consensus map Linkage A07
Position 44.821
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Macedo et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea