Peanut Marker Database

TC21D06 Information

Marker name TC21D06
Marker category Publicly available markers
Primer sequences Fw ATCCTTACCCCAAAGCAACG
Rv TGGTGATGGAGTTGAATGAATG
EST/Genome sequences
Lines
PIC Value
Lines
Map BF6 Linkage BB08
Position 14.47
BF6 Linkage BB08
Position 14.47
TF6 Linkage TA08
Position 53.454
TF6 Linkage TB08
Position 13.788
Integrated consensus map Linkage B08
Position 52.425
Integrated consensus map Linkage A08
Position 68.756
Integrated consensus map Linkage B08
Position 49.578
Integrated consensus map Linkage B08
Position 52.425
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Macedo et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea