Marker name | TC21D06 | ||
---|---|---|---|
Marker category | Publicly available markers | ||
Primer sequences | Fw | ATCCTTACCCCAAAGCAACG | |
Rv | TGGTGATGGAGTTGAATGAATG | ||
EST/Genome sequences | |||
Lines | |||
PIC | Value | ||
Lines | |||
Map | BF6 | Linkage | BB08 |
Position | 14.47 | ||
BF6 | Linkage | BB08 | |
Position | 14.47 | ||
TF6 | Linkage | TA08 | |
Position | 53.454 | ||
TF6 | Linkage | TB08 | |
Position | 13.788 | ||
Integrated consensus map | Linkage | B08 | |
Position | 52.425 | ||
Integrated consensus map | Linkage | B08 | |
Position | 52.425 | ||
Integrated consensus map | Linkage | A08 | |
Position | 68.756 | ||
Integrated consensus map | Linkage | B08 | |
Position | 49.578 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Macedo et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.