Peanut Marker Database

TC21C03 Information

Marker name TC21C03
Marker category Publicly available markers
Primer sequences Fw TAAAGTTTCCGTCGTTTTGTCA
Rv AAAGATGAACAAGGTTGCAGAA
EST/Genome sequences JN887523
Lines
PIC Value
Lines
Map BF6 Linkage BB09
Position 15.885
TF6 Linkage TA09
Position 40.053
Integrated consensus map Linkage B09
Position 71.226
Integrated consensus map Linkage A09
Position 86.078
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Macedo et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea