Peanut Marker Database

TC20D05 Information

Marker name TC20D05
Marker category Publicly available markers
Primer sequences Fw CAGCACCACATGATTGTCTTTA
Rv GATCAAACCCTCCATAATCGTA
EST/Genome sequences JN887519
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 24.609
TF6 Linkage TA07
Position 22.314
Integrated consensus map Linkage A07
Position 56.851
Integrated consensus map Linkage B01
Position 38.36
Integrated consensus map Linkage A01
Position 81.959
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Macedo et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea