Peanut Marker Database

TC20B05 Information

Marker name TC20B05
Marker category Publicly available markers
Primer sequences Fw GCATGTAAACTATGCAATCGCT
Rv CAACAACTTATTCCACCAAATATCA
EST/Genome sequences JN887518
Lines
PIC Value
Lines
Map AF5 Linkage AA08
Position 61.76
TF6 Linkage TB08
Position 0.0
TF6 Linkage TA08
Position 55.115
Integrated consensus map Linkage A08
Position 71.275
Integrated consensus map Linkage B08
Position 46.198
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Macedo et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea