Marker name | TC20B05 | ||
---|---|---|---|
Marker category | Publicly available markers | ||
Primer sequences | Fw | GCATGTAAACTATGCAATCGCT | |
Rv | CAACAACTTATTCCACCAAATATCA | ||
EST/Genome sequences | JN887518 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | AF5 | Linkage | AA08 |
Position | 61.76 | ||
TF6 | Linkage | TA08 | |
Position | 55.115 | ||
TF6 | Linkage | TB08 | |
Position | 0.0 | ||
Integrated consensus map | Linkage | B08 | |
Position | 46.198 | ||
Integrated consensus map | Linkage | A08 | |
Position | 71.275 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Macedo et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.